SpliceScanII scoring putative internal exons

This program is further improved tool SpliceScan, where we score splice sites based on exon definition model, which includes simultaneous scoring of acceptor and donor signals, exon length distribution and contribution of Exonic/Intronic Enhancer/Silencer elements associated with the delicate balance of factors committing exons to splicing. All the scoring happens through Bayesian rule in terms of LODs (Logarithm Of Odds), where the LOD is the logarithm base 2 of the signal concentration ratio in vicinity of a true versus decoy splice site. Please refer to our publication on SpliceScan II for further details:

Alexander Churbanov, Igor Vorechovsky and Chindo Hicks A method of predicting changes in
human gene splicing induced by genetic variants in context of cis-acting elements, BMC
Bioinformatics 2010, 11:22
          
Presentation made at BIG is available here.

Please input pre-mRNA nucleotide sequences, which you would like to score in FASTA format. Your input should look similar to this where the homology-based gene structural annotation for this fragment could be found here. FASTA id, number of sequences and comments may vary. Please remember that pre-mRNA is a single-stranded molecule, therefore if gene is located on anti-sense strand the pre-mRNA orientation should be reverse compliment of the containing DNA locus. Also, in your submission please allow 400 nt or more at the intronic flanks for an exon of interest. Shorter flanks might not work well for the prediction purposes.

The resulting prediction displays in the format shown below, where TEST4 stands for FASTA ID of a sequence we examine, putative internal exon predicted has start and end indexes within the sequence, overall LOD score normalized according to the true exonic human LOD score distribution histogram in the range [0,1] where, for example, 0 is the weakest possible score assigned to a putative exon still to be considered as true. The LOD score features within * entries are donor, acceptor and exonic length scores. Donors and acceptors have normalized scores coming from the Bayesian splice site sensor with their translation to the corresponding LOD score. Normally, stronger splice sites can comfort shorter exons, so that we score the exonic length according to the histograms recorded for various splice sites strength combination. All the options in + marked entries are either the LOD score for competing splice sites trying to destabilize the exonic boundaries or the LOD scores for the Enhancers/Silencers.

PREDICTION FOR >>>TEST4<<<

EXON LOCATED AT 206 - 342 HAS LOD SCORE -4.20 NORMALIZED 0.60
	* ACCEPTOR CACGTCTGTACTCTCCTCAGGTT LOCATED AT 206
		OF STRENGTH 0.59 WITH LOD SCORE -2.62
	* DONOR CAGGTCAGC LOCATED AT 342
		OF STRENGTH 0.28 WITH LOD SCORE -3.75
	* EXON OF SIZE 137 WITH LOD SCORE 1.47
		+ ACCEPTOR IN POST-DONOR AREA CTTGTCTCTCCTCCCCACAGTGT
			LOCATED AT 359 - 381 WITH LOD SCORE 1.01
		+ ACCEPTOR INSIDE EXON TTCAATGTGTCCTACACCAGGCA
			LOCATED AT 300 - 322 WITH LOD SCORE -0.31
           

Input your query in FASTA format here:



or file to upload:

Some system parameters  Show explanation behind prediction
 Report only strongest exons predicted
 Show exons with non-canonical GC donor
 Make graphical output

Note: SpliceScan II is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details.
Home